leBIBI Fasta QueriesΒΆ

A nucleic sequence can be submitted in Fasta Format for exemple :

on one line

example:

>09c49c40c856cab034c044e2054c7ad077a7e057_810
TGGCTCAGGATGAACGCTGGCGGTATGCTTAACACATGCAAGTCGGACGAGAGTTTTTAACTCTAGTGGCGAACGGGTGCGTAATACGTGAGAATCTGCCCTTAGGAGAAGAATAACTGCTGGAAACGGTAGCTAAGTCTTTATATGCCGAGAGGTGAAATAGTTTAGACTGCCTAGGGATGAGCTCACGCCTGATTAGCTTGTTGGTAAGGTAATGGCTTACCAAGGCCACGATCAGTAGCTGGTTTGAGAGAACGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTCCGGGAGGCAGCAGTGAGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAGAACTGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCCG

or more lines

example:

>8daa886b4c64874650565881a6dcf22aa58e88d5_413
TGGCTCAGGATGAACGCTGGCGGTATGCTTAACACATGCAAGTCGGACGAGAGTTTTTAA
CTCTAGTGGCGAACGGGTGCGTAATACGTGAGAATCTGCCCTTAGGAGAAGAATAACTGC
TGGAAACGGTAGCTAAGTCTTTATATGCCGAGAGGTGAAATAGTTTAGACTGCCTAGGGA
TGAGCTCACGCCTGATTAGCTTGTTGGTAAGGTAATGGCTTACCAAGGCCACGATCAGTA
GCTGGTTTGAGAGAACGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTCCGGG
AGGCAGCAGTGAGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAG
GGATGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAGAACTGACGGTACTTG
AGGAATAAGCCACGGCTAATTCCGTGCCAGCAG

Previous topic

Optimal strategy for phylogenetic positionning

Next topic

leBIBI-QBPP Explained

This Page